Home | About Us | Editorial Board | Current Issue | Archives | Search | Instructions | Subscription | Feedback | e-Alerts | Login 
Journal of Indian Society of Pedodontics and Preventive Dentistry Official publication of Indian Society of Pedodontics and Preventive Dentistry
 Users Online: 3173  
 
  Print this page Email this page   Small font sizeDefault font sizeIncrease font size


 
  Table of Contents    
ORIGINAL ARTICLE
Year : 2020  |  Volume : 38  |  Issue : 1  |  Page : 8-13
 

Single-nucleotide polymorphism in Vitamin D receptor gene and its association with dental caries in children


1 Department of Oral Medicine and Radiology, Sree Balaji Dental College and Hospital, BIHER University, Chennai, Tamil Nadu, India
2 Department of Human Genetics Research Laboratory, Sree Balaji Dental College and Hospital, BIHER University, Chennai, Tamil Nadu, India

Date of Submission17-Jul-2019
Date of Decision22-Aug-2019
Date of Acceptance21-Oct-2019
Date of Web Publication12-Mar-2020

Correspondence Address:
Dr. Nalini Aswath
Department of Oral Medicine and Radiology, Sree Balaji Dental College and Hospital, BIHER University, Chennai - 600 042, Tamil Nadu
India
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/JISPPD.JISPPD_222_19

Rights and Permissions

 

   Abstract 


Background: Though factors such as diet, oral hygiene, salivary flow and surface characteristics of the tooth enamel play a role in the causation of dental caries, genetic factors also contribute significantly in influencing the susceptibility or resistanance to the occurrence of caries. Aims and Objectives: To analyse the relationship between a single nucleotide polymorphism in the vitamin D receptor gene TaqI locus and associate its presence with dental caries in children. Materials and Methods: A case control study was conducted among 120 children in the age group of 6-12 years. 60 cases with a DMFT of >3 and 60 controls with a DMFT of 0 were selected. Genomic DNA was extracted from salivary samples collected from the patients and presence of polymorphism was analyzed by PCR-RFLP. Results: Pearson chi square test and Fisher exact tests were used for comparison of differences in genotypes or allele frequencies between groups. No significant difference between the cases and control was observed among the different genotypes and the alleles. However, there was an inclination in the incidence of caries with the genotype 'tt' and 'Tt' when compared with the genotype'TT'. Conclusion: In this study done to analyse the SNP in vitamin D receptor gene and its association with dental caries in children indicates a higher caries risk for a patient with't' allele and 'tt' genotype.


Keywords: Dental caries, single-nucleotide polymorphism, TaqI locus, Vitamin D receptor gene


How to cite this article:
Aribam VG, Aswath N, Ramanathan A. Single-nucleotide polymorphism in Vitamin D receptor gene and its association with dental caries in children. J Indian Soc Pedod Prev Dent 2020;38:8-13

How to cite this URL:
Aribam VG, Aswath N, Ramanathan A. Single-nucleotide polymorphism in Vitamin D receptor gene and its association with dental caries in children. J Indian Soc Pedod Prev Dent [serial online] 2020 [cited 2020 Nov 26];38:8-13. Available from: https://www.jisppd.com/text.asp?2020/38/1/8/280513





   Introduction Top


Dental caries can be defined as a complex, chronic, multifactorial disease and one of the most prevalent diseases in industrialized and developing countries.[1]

One out of two children in India is affected by dental caries, and there is an increase in caries burden in deciduous dentition. The combined prevalence of dental caries in Indian children is >50%, and average dmf/DMF (d: decayed, m: missing, f: filled, t: tooth for deciduous teeth/d: decayed, m: missing, f: filled, t: tooth for deciduous teeth) values are between 2 and 3 in all the age groups.[2] DMFT index score for Indian children was around 2, and caries prevalence was increasing with age from 51.9% to 63.1% in 5–15 years of age group, respectively, according to the last National Oral Health Survey conducted in 2002–2003.[3]

Regardless of all the etiological factors such as diet, oral hygiene, salivary flow, and surface characteristics of the tooth enamel, there are individuals who appear to be more susceptible to caries and those who are extremely resistant, which suggest that genetic factors also influence the development of caries.

In craniofacial development and maintenance of good oral health, Vitamin D plays a principal role and also affects enamel and dentin formation. During periods of primary and permanent tooth formation, events of malnutrition and Vitamin D deficiency can result in enamel hypoplasia and dental caries.[4] Odontoblasts and ameloblasts are the target cells for Vitamin D function. Vitamin D receptor (VDR) deficiency influences odontoblast.[5] ApaI (VDR 7975232 C > T), BsmI (VDR 1544410 A > G), FokI (VDR 2228570 C > T), and TaqI (VDR 731236 T > C) are some of the polymorphisms of the VDR gene.[6]

One of the most common known of the single-nucleotide polymorphisms (SNPs) is Taq1 (rs731236) (T > C, chromosome position: 48238757). It is a synonymous polymorphism located on codon 352 (isoleucine) of exon 9 near the 3' untranslational region of VDR gene on band 13 of long arm of chromosome12.[7] Morphogenic abnormalities, matrix disorganization, and hypomineralization are the major features of the Vitamin D pathway disturbance during tooth formation. Due to its central role in bone and tooth formation, children and adolescents are particularly vulnerable to the clinical manifestations of insufficient Vitamin D.[8] Therefore, the objective of this study is to analyze the relationship between a SNP in the VDR TaqI locus and associate its presence with dental caries in children.


   Materials and Methods Top


A case–control study was conducted among 120 children aged between 6 and 12 years. The DMFT and dmft indices were recorded according to the WHO criteria (1997). Sixty cases with a DMFT of >3 and sixty controls with a DMFT of 0 were selected by purposive random sampling. Children with any systemic disease were excluded. Ethical approval was obtained from the institutional ethics committee, and written informed consent was acquired from each parent or guardian.

DNA Extraction

Salivary samples obtained from participants with or without caries were centrifuged at 10,000 rpm for 3 min at room temperature to pellet cells. The pelleted cells were washed once with phosphate-buffered saline pH 7.5, and suspended in 0.1 ml of cell lysis buffer (containing 0.1% sodium dodecyl sulfate (SDS), 25 mM ethylenediaminetetraacetic acid, 75 μg/100 μl Proteinase-K, and 200 mM Tris-Cl at pH 8 [Sigma-Aldrich, St. Louis, MO, USA]). These samples were then incubated at 57°C for 12 h with intermittent agitation.

Subsequently, the 200 μl of 100 mM ammonium acetate was added to the cell lysates, mixed, and incubated at room temperature for 15 min. The samples were then centrifuged at 12,000 rpm for 15 min to precipitate protein fraction in cell lysate. Subsequently, one-sixth volume of isopropanol was added to all the samples, mixed, and centrifuged at 12,500 rpm for 15 min at room temperature to precipitate the genomic DNA.

Polymerase chain reaction

Primers designed to specifically amplify 493 base pair region of exon 9 of VDR gene containing the SNP rs731236 at codon 352 were used to amplify the SNP region. The following set of primers was used:

  • VDRTaqF1: ATAGCAGAGCAGAGTTCCAAGC
  • VDRTaqR1: GTCGGCTAGCTTCTGGATCATC.


Polymerase chain reaction (PCR) was performed on 100 ng of DNA samples under the following conditions: after an initial denaturation at 94°C for 5 min, the samples were amplified for 35 cycles with denaturation at 94°C for 30 s, primer annealing at 55°C for 30 s, and primer extension at 72°C for 30 s. A final extension at 72°C for 5 min was performed before stopping the amplification reaction.

Amplifications were performed in a 25 μl reaction and were confirmed for their specificity by running a 5 μl aliquot of the reaction in a 1.5% agarose gel. Most of the samples migrated at the expected size of 493 base pairs. A few samples, however, either did not show any amplification (marked by upward arrow) or showed nonspecific amplification (marked by downward arrow). While samples that showed nonspecific amplification were not included in the analysis, those that did not show amplification were reamplified with higher concentration of DNA. [Figure 1] and [Figure 2] show gel images of PCR amplicons of DNA extracted from control and caries, respectively.
Figure 1: Gel images of polymerase chain reaction amplicons of DNA extracted from the control group

Click here to view
Figure 2: Gel images of polymerase chain reaction amplicons of DNA extracted from the caries group

Click here to view


RESTRICTION FRAGMENT LENGTH POLYMORPHISM (PCRRFLP) ANALYSIS AND DETECTING THE “TT,” “Tt,” AND “tt” POLYMORPHISM.

The amplification products of PCR were digested with Taq1 restriction enzyme in a 25 μl reaction volume at 65°C for 1 h in a thermal cycler. The digested products were analyzed by running a 10 μl aliquot in a 2% agarose gel at 50V for 30 min.

Based on the occurrence of the polymorphism(s), Taq1 restriction enzyme cuts the PCR amplicons into any one of the following manners:

  1. If the PCR amplicon contains TCGA/TCGA (“tt” genotype), the Taq1 enzyme cuts the 493 base pair PCR amplicon into 382 base pair + 111 base pair fragments. Agarose gel electrophoresis of the Taq1-digested PCR amplicons is displayed as twin bands migrating in the gel
  2. If the PCR amplicon contains TCGA/TTGA (“Tt” genotype), the PCR amplicons containing TCGA will be cut into 382 base pair + 111 base pair fragments, whereas those PCR fragments containing TTGA will not be cut by the Taq1 enzyme. Agarose gel electrophoresis of the Taq1-digested PCR amplicons is displayed as triplet bands (493 base pair + 382 base pair + 111 base pair) migrating in the gel
  3. If the PCR amplicon contains TTGA/TTGA (“TT” genotype), the Taq1 enzyme does not cut the PCR amplicons. Agarose gel electrophoresis of the Taq1-digested PCR amplicons is displayed as a single band (493 base pair) migrating in the gel.


A representative of agarose gel electrophoresis of the digestion products of control and caries is shown in [Figure 3] and [Figure 4], respectively.
Figure 3: Agarose gel electrophoresis of the digestion products of control

Click here to view
Figure 4: Agarose gel electrophoresis of the digestion products of caries

Click here to view


Statistical analysis

The statistical analysis was done using IBM SPSS software version 24.0. The Pearson Chi-square test and Fisher's exact tests were used for comparison of differences in genotypes or allele frequencies between groups. Odds ratio, confidence interval, and P value were calculated.


   Results Top


The distribution of “TT”/“Tt”/“tt” polymorphism in the sample was tabulated. The distribution of “TT,” “Tt,” and “tt” in the caries group was 36.6%, 41.6%, and 21.6%, respectively, whereas in the normal group, the distribution of “TT,” “Tt,” and “tt” was 43.3%, 38.3%, and 18.3%, respectively, which clearly indicates that the distribution of “TT” genotype is more in normal control group than the caries group. The “Tt” and “tt”genotype distribution is more in the caries group as compared to the normal control group. Pearson's Chi-square test revealed P = 0.747. When the distribution of the genotypes “TT,” “Tt,” and “tt” between the cases and controls was statistically analyzed, P = 0.58 for “TT” genotype, 0.85 for “Tt” genotype, and 0.82 for “tt” genotype were obtained. The odds ratio revealed that there was a 0.76 times lower chance for a caries person to have the genotype “TT,” 1.15 times higher chance for a caries person to have the genotype “Tt,” and 1.23 times higher chance for a caries person to have the genotype “tt” [Table 1].
Table 1: Vitamin D receptor genotype comparisons with cases and controls

Click here to view


When the “T” allele was compared among the case and the control groups, P = 0.43 was obtained. Although not statistically significant, we saw that there was 0.81 times lower chance of a caries person to have the “T” allele compared to a caries-free person having the same allele. When the “t” allele was analyzed between the case and control groups, there was 1.23 higher times higher chance of a caries person to have the “t” allele compared to a caries-free person having the same allele [Table 2].
Table 2: Allele type comparisons with cases and controls

Click here to view



   Discussion Top


Dental caries is a widely prevalent disease worldwide. According to the Global Oral Health Data Bank, the prevalence varies from 49% to 83% across different countries. It has shown to have a negative impact on the health-related quality of life irrespective of age.[9] While there is clear evidence that dental caries is multifactorial, there seems to be a contributory genetic component in the etiology of the disease.

Oral bone loss, periodontal disease, and loss of teeth have been associated with deficient concentrations of 25-hydroxyvitamin D (25(OH)D), and it has been shown that supplementation with Vitamin D improves clinical periodontal outcomes. Through the efforts of Mellanby et al., much of the early focus on the role of Vitamin D in caries occurred in the 1920s and 1930s. The beneficial effects of Vitamin D supplementation in reducing dental caries in children have been documented in various historical reports.[4] Caries was strongly associated with bone mineral density and this likely reflected a caries-Vitamin D association.[10]

Through actions on intestinal absorption, renal reabsorption, as well as through trapping and mobilization of calcium and phosphorus from mineralized tissues, the Vitamin D pathway systemically manages mineral homeostasis. Various studies using both animal models and human trials have shown that disruption of the Vitamin D pathway leads to inadequate levels of calcium and phosphorous in circulating plasma which decreases the mineralization of skeletal bones and also has a negative impact on the formation of teeth.[5]

The Taq I polymorphism that is characterized by a single-base transition (T > C) leading to a synonymous change at codon 352 in exon 9 belongs to the most studied variant. It creates a Taq I restriction site; resulting alleles are called “T” (Taq I site absent) and “t” (Taq I site present).[11]

Izakovicova Holla et al.[11] did a study where they found no significant differences in VDR TaqI allele and genotype frequencies between caries-free and caries-affected children which is consistent with our result. Hu et al.[12] suggested that the “t” allele and “Tat” genotype might be risk factors of susceptibility to dental caries in adults. They suggested that heterozygous “Tat” genotype of the VDR Tami gene has elevated susceptibility to caries and added that “t” allele may be a disease susceptibility gene for caries. Cogulu et al.[10] showed that there was a statistically significant difference in the frequency of TaqI genotypes (“tt”) between caries-active and caries-free children (P = 0.029).

Kong et al.[13] showed that VDR BsmI polymorphism was associated with the risk of deciduous tooth decay in Chinese children aged 4–7 years. Morrison et al. established that homozygotes (“tt” genotype) for a variant of the VDR are associated with decreased bone mineral density.[14]

In our study, there was no statistically significant difference between the different genotypes in case and control groups. However, when the comparison of the distribution of the various genotypes was statistically analyzed using Fisher's exact test, the odds ratio revealed that individuals having the genotype “tt” and the allele “t” may be more susceptible to dental caries which may suggest that T allele has protective nature against caries. There was an inclination in the incidence of caries with the genotype “tt” and “Tt” when compared with the “TT” genotype.

Literature reveals that there is a strong association between the incidence of caries and bone mineral density. Homozygotes (tt genotype), a variant of the VDR, are associated with decreased bone mineral density.[14] This could explain the results of our study that the individuals having “tt” and “Tt” genotype and the “t” allele are more prone to dental caries as compared to the TT genotype and the T allele. Individuals with decreased bone mineral density will be more prone to dental caries. The limitation of this study was that we only focused on Taq1 locus of VDR gene, and the sample size was small.


   Conclusion Top


Although there were no statistically significant differences in the results of our study, there was an inclination in the incidence of caries with the genotype “tt” and “Tt” when compared with the “TT” genotype and the “t” allele as compared to the “T” allele. VDR gene polymorphism may be used as a biomarker for predicting the occurrence of dental caries. Individuals with the “t” allele and genotypes “tt” and “Tt” may be more prone to the occurrence of dental caries since it was established that the individuals having the “tt” genotype have decreased bone mineral density. Further studies on a large number of samples are required to arrive at a definite conclusion.

Acknowledgment

The authors wish to thank DST-FIST (Ref. No. SR/FST/College-23/2017), Government of India, New Delhi, for providing the research equipment facilities to Sree Balaji Dental College and Hospital, Pallikaranai, Chennai, Tamil Nadu, India.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.



 
   References Top

1.
Petersen PE. The world oral health report 2003: Continuous improvement of oral health in the 21st century – The approach of the WHO global oral health programme. Community Dent Oral Epidemiol 2003;31 Suppl 1:3-23.  Back to cited text no. 1
    
2.
Mehta A. Trends in dental caries in Indian children for the past 25 years. Indian J Dent Res 2018;29:323-8.  Back to cited text no. 2
[PUBMED]  [Full text]  
3.
Bali RK, Mathur VB, Talwar PP, Chanana HB. National Oral Health Survey and Fluoride Mapping 2002-2003 India. New Delhi: Dental Council of India 2004. p. 132.  Back to cited text no. 3
    
4.
Schroth RJ, Rabbani R, Loewen G, Moffatt ME. Vitamin D and dental caries in children. J Dent Res 2016;95:173-9.  Back to cited text no. 4
    
5.
Zhang X, Beck P, Rahemtulla F, Thomas HF. Regulation of enamel and dentin mineralization by Vitamin D receptor. Comp Dent Morphol 2009;13:102-9.  Back to cited text no. 5
    
6.
Schuch NJ, Garcia VC, Vívolo SR, Martini LA. Relationship between Vitamin D receptor gene polymorphisms and the components of metabolic syndrome. Nutr J 2013;12:96.  Back to cited text no. 6
    
7.
Ale Ahmad A, Saburi E, Rajaei T, Mortazavi Y. Taq1 polymorphism (rs731236) of Vitamin D receptor gene in children with acute lymphoblastic leukemia. IJBC 2017;9:116-20.  Back to cited text no. 7
    
8.
Davideau JL, Lezot F, Kato S, Bailleul-Forestier I, Berdal A. Dental alveolar bone defects related to Vitamin D and calcium status. J Steroid Biochem Mol Biol 2004;89-90:615-8.  Back to cited text no. 8
    
9.
Frencken JE, Sharma P, Stenhouse L, Green D, Laverty D, Dietrich T. Global epidemiology of dental caries and severe periodontitis-a comprehensive review. Clin Peridontol 2017;44 Suppl 18:S94-105.  Back to cited text no. 9
    
10.
Cogulu D, Onay H, Ozdemir Y, Aslan GI, Ozkinay F, Eronat C. The role of Vitamin D receptor polymorphisms on dental caries. J Clin Pediatr Dent 2016;40:211-4.  Back to cited text no. 10
    
11.
Izakovicova Holla L, Borilova Linhartova P, Kastovsky J, Bartosova M, Musilova K, Kukla L, et al. Vitamin D receptor TaqI gene polymorphism and dental caries in Czech children. Caries Res 2017;51:7-11.  Back to cited text no. 11
    
12.
Hu XP, Li ZQ, Zhou JY, Yu ZH, Zhang JM, Guo ML. Analysis of the association between polymorphisms in the Vitamin D receptor (VDR) gene and dental caries in a Chinese population. Genet Mol Res 2015;14:11631-8.  Back to cited text no. 12
    
13.
Kong YY, Zheng JM, Zhang WJ, Jiang QZ, Yang XC, Yu M, et al. The relationship between Vitamin D receptor gene polymorphism and deciduous tooth decay in Chinese children. BMC Oral Health 2017;17:111.  Back to cited text no. 13
    
14.
Morrison NA. Prediction of bone density from vitamin D receptor alleles. Nature 1994;367:284-7.  Back to cited text no. 14
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1], [Table 2]



 

Top
Print this article  Email this article
 

    

 
  Search
 
  
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Article in PDF (1,017 KB)
    Citation Manager
    Access Statistics
    Reader Comments
    Email Alert *
    Add to My List *
* Registration required (free)  


    Abstract
   Introduction
    Materials and Me...
   Results
   Discussion
   Conclusion
    References
    Article Figures
    Article Tables

 Article Access Statistics
    Viewed1662    
    Printed77    
    Emailed0    
    PDF Downloaded222    
    Comments [Add]    

Recommend this journal


Contact us | Sitemap | Advertise | What's New | Copyright and Disclaimer 
  2005 - Journal of Indian Society of Pedodontics and Preventive Dentistry | Published by Wolters Kluwer - Medknow 
Online since 1st May '05